The breast is composed of several glands and ducts that lead to the nipple and the surrounding colored area called the areola effect of kamagra on woman
B Padmanabham
B Padmanabham @ Peasad
22 Years Exp
Investment/Realestate Claims (Show More)
Chittoor , Bhavani Nagar
View Answers by this Partner (0)
Profile Views : 46709
Information
overview
CLAIMS AGAINST REAL ESTATE AGENTS AND DEVELOPERS
It's unfortunate that the common practice for land developers is to delay or completely avoid handing over of built apartments at the prescribed time
This results in monetary loss and mental stress to the customers
To resolve such matters a consumer complaint needs to be filed in the State Consumer Commission
This is the quickest legal path for bringing defrauding developers and builders to book
It is a highly expeditious and effective way to get the developers to deliver the property or refund the money along with interest and damages
In the present scenario, Consumer courts in India have become quick and aggressive
A penal interest is charged from the date of possession mentioned in the original agreement
Without an overseas citizen having to travel to India a complete representation is provided by us throughout the matter till it reaches its logical end.
The company has an online case management system through which an NRI is able to track the progress of a particular case. Regular progress and updates will be available to the client throughout the pendency of the matter with us which can be viewed after logging into our systems through an unique password.
REQUIRED INFORMATION
Scanned copy of the original agreement executed with the real estate company
Copy of all the communication done i.e. e-mails, postal mails etc
The total cost of the property
Proof of payment sent to the builder
Photos
Reviews
The primers used were p53 int1 fwd 5 CACAAAAACAGGTTAAACCCA 3 and p53 int10 rev 5 GAAGACAGAAAAGGGGAGGG 3; the composition of the PCR mix was as described above doxycycline before and after Cetirizine Zyrtec Pfizer, a histamine H 1 receptor antagonist, has been approved by the US Food and Drug Administration for treatment of seasonal allergic rhinitis, perennial allergic rhinitis and
Name : B Padmanabham @ Peasad
Law Firm Name : B Padmanabham
Country : India
City : Chittoor
State : ANDHRA PRADESH
Practicing Since: 2003
About Your Firm : Myself practising advocate since 2003 at Tirupati and Hyderabad.
| Sr Employee Associated | Sr Employee Enrollment/Reg.No | Sr Employee Enrollment/Reg.State |
|---|---|---|
| Jr Employee Associated | Jr Employee Enrollment/Reg.No | Jr Employee Enrollment/Reg.State |
Legal & Drafting
Lease/Rental Agreements ( Commercial Lease Agreement )
Property & Documents Inspection ( Plot/Site Insepction )
Power of Attorneys ( Special Power of Attorney )
e-stamp paper ( Get E-stamp paper )
Procure Revenue Documents ( Khata Extract )
Registration Assistance ( Agriculture Land )
Agreements/Deeds ( Mortgage Deed )
Legal Opinion (Written) ( Agriculture Land )
Procure Revenue Documents ( Certified copy of registered documents )
Lease/Rental Agreements ( Residential Lease Agreement )
Property & Documents Inspection ( House/Apartment Inspection )
Power of Attorneys ( Revoke/cancel Power of Attorney )
Procure Revenue Documents ( Khata Certificate )
Registration Assistance ( Commercial Property )
Agreements/Deeds ( Exchange Deed )
Legal Opinion (Written) ( Commercial Property )
Procure Revenue Documents ( Other Revenue Documents )
Lease/Rental Agreements ( Room Rental Agreement )
Property & Documents Inspection ( Documents Inspection in Govt Office )
Wills ( Make A will )
Procure Revenue Documents ( Khata Transfer )
Registration Assistance ( Revenue/Other Site )
Agreements/Deeds ( Release Deed )
Legal Opinion (Written) ( Revenue/Other Site )
Packages ( Legal Opinion to Registration (Plot/Site) )
Lease/Rental Agreements ( Office Sharing Agreement )
Property & Documents Inspection ( Documents Inspection in Builder Office )
Wills ( Make A Codicil )
Procure Revenue Documents ( Mother Deed Extract )
Agreements/Deeds ( Agreement of Sale )
Agreements/Deeds ( Partition Deed )
Affidavits ( Name & Address Affidavits )
Packages ( Sale Agreement to Registration (Plot/Site) )
Lease/Rental Agreements ( Car Parking Agreement )
Property & Documents Inspection ( Fraud & forgery Inspection )
Consultation on Property ( Property Buying )
Procure Revenue Documents ( Copy of Grant Certificate )
Agreements/Deeds ( Construction Agreement )
Agreements/Deeds ( Memorandum of Understanding )
Affidavits ( Personal Affidavits )
Packages ( Sale Agreement to Registration (Apartment) )
Lease/Rental Agreements ( Settlement Of Rental Agreement )
Property & Documents Inspection ( Agriculture Land Inspection )
Consultation on Property ( Property Selling )
Procure Revenue Documents ( Pahani/RTC )
Agreements/Deeds ( Sale deed )
Agreements/Deeds ( Joint Development Agreement )
Affidavits ( Student Affidavits )
Packages ( Legal Opinion to Registration (Apartment) )
Construction Approvals ( Residential )
Lease/Rental Agreements ( Paying Guest Agreement )
Property & Documents Inspection ( Industrial / Commercial Inspection )
Procure Revenue Documents ( Mutation )
Agreements/Deeds ( Gift Deed )
Lease/Rental Agreements ( Apartment Rental Agreement )
Affidavits ( Passport Affidavits )
Utility/Property Payments ( Property Tax Payment )
Construction Approvals ( Commercial )
Lease/Rental Agreements ( Leave And Licence )
Registration Assistance ( Plot )
Legal Opinion (Written) ( Plots )
Procure Revenue Documents ( Electricity Bill Name Transfer )
Agreements/Deeds ( Sale Agreement/Deed Review )
Lease/Rental Agreements ( House Rental agreement )
Affidavits ( Gas Affidavits )
Utility/Property Payments ( Electricity Bill Payment )
Notary & Attestation Services ( Get A Document Notarised )
Lease/Rental Agreements ( NOC From Landlord )
Registration Assistance ( Apartment )
Legal Opinion (Written) ( Apartment )
Procure Revenue Documents ( Duplicate/Certified copy of sale deed )
Agreements/Deeds ( Construction Agreement Review )
Lease/Rental Agreements ( Commercial Office Rental Agreement )
Affidavits ( General Affidavits )
Utility/Property Payments ( Water Bill Payment )
Notary & Attestation Services ( Gazetted Officer Attestation )
Lease/Rental Agreements ( Other Lease/Rental Agreements )
Registration Assistance ( Villas )
Agreements/Deeds ( Rectification Deed )
Legal Opinion (Written) ( Villas )
Procure Revenue Documents ( Certified copy of revenue document )
Lease/Rental Agreements ( Commercial Shop Rental Agreement )
Affidavits ( Other Affidavits )
Power of Attorneys ( General Power of Attorney )
Notary & Attestation Services ( Tenant Police Verification )
Procure Revenue Documents ( Encumbrance Certificate )
Registration Assistance ( Independent House )
Agreements/Deeds ( Relinquishment deed )
Legal Opinion (Written) ( Independent House )
Procure Revenue Documents ( Certified copy of registered GPA/SPA )
NRI Services
Property Search ( Land And Property Search )
Propert Transfer ( Land and Property Transfer )
Property Partition ( Partition of Land And Property )
Investment/Realestate Claims ( Investment/Realestate Claims )
Landlord Tenant Disputes ( Landlord Tenant Disputes )
Succession Certificate ( Succession Certificate )
Property Disputes ( Illegal Sale of Land And Property )
Power of Attorneys for NRIs ( General Power of Attorney by NRI )
Property Disputes ( Illegal Transfer of Land And Property )
Power of Attorneys for NRIs ( Special Power of Attorney by NRI )
Property Disputes ( Illegal occupation of Land and Property )
Buying Selling of Property in India ( Buying/Selling of Property in India )
Realtors
RERA Consultation ( RERA Approved Agent )
RERA Consultation ( RERA Consultant )
RERA Consultation ( RERA Compliance Residential )
No Answers Found
