The breast is composed of several glands and ducts that lead to the nipple and the surrounding colored area called the areola effect of kamagra on woman
B Padmanabham
B Padmanabham @ Peasad
23 Years Exp
Land And Property Search (Show More)
Chittoor , Bhavani Nagar
View Answers by this Partner (0)
Profile Views : 53888
Information
Overview
Land and Property Search
For overseas citizens who either inherit or purchase some piece of land or other property, it is quite a challenge to handle matters or resolve disputes related to the asset. In case of any conflict, especially when they have to fight for their rightful share, they are faced with a host of problems:
Emotional trauma of handling unscrupulous relatives.
Psychological harassment of understanding confusing process technicalities.
Complexities of seeking property information-further compounded if property ownership is also an issues.
Lack of awareness about who owns property or even how to check property ownership.
Inability to take the load of technical and unfamiliar jargon due to time, work and leave issues and traveling back and forth.
Helplessness in attempts to check property ownership clearly or understanding why it is imperative to find owners of property before anything further is done.
Once he gets into the property ownership search process, he gets furtheroverwhelmed by issues of land registry and inheritance laws.
A feeling of defeat and frustration even before he visits home or seeks his share.
With regard to property issues, what does an overseas citizen want?
Quite simply, they seek a soothing and efficient system somebody to relate to their issues, somebody to understand the nuances of both their needs and their limitations, somebody who just knows and does what needs to be done.
Why Propertified?
We offer a one stop, committed, diligent, efficient and focused team to handle all such issues.
Our Motto: -Systematic approach regarding property ownership search, land registry title search and getting the ownership documents in order -Simplify all details about land registry deeds so that the client can comprehend things clearly. -Give the client a comprehensive report that introduces him to both the area and valuation of his land focusing on the aspects listed below.
Description of the land / property
Calculation of the total land area
Property Ownership details
Property Title Search
Estimating the size of shares of all co-owners
Locating documents related to transfers if any
Documenting details about possession of the land
Current market valuation of the property
Systematic advice on further action
Photographs and videos (on special request)
Photos
Reviews
The primers used were p53 int1 fwd 5 CACAAAAACAGGTTAAACCCA 3 and p53 int10 rev 5 GAAGACAGAAAAGGGGAGGG 3; the composition of the PCR mix was as described above doxycycline before and after Cetirizine Zyrtec Pfizer, a histamine H 1 receptor antagonist, has been approved by the US Food and Drug Administration for treatment of seasonal allergic rhinitis, perennial allergic rhinitis and
Name : B Padmanabham @ Peasad
Law Firm Name : B Padmanabham
Country : India
City : Chittoor
State : ANDHRA PRADESH
Practicing Since: 2003
About Your Firm : Myself practising advocate since 2003 at Tirupati and Hyderabad.
| Sr Employee Associated | Sr Employee Enrollment/Reg.No | Sr Employee Enrollment/Reg.State |
|---|---|---|
| Jr Employee Associated | Jr Employee Enrollment/Reg.No | Jr Employee Enrollment/Reg.State |
Legal & Drafting
Property & Documents Inspection ( Industrial / Commercial Inspection )
Construction Approvals ( Residential )
Lease/Rental Agreements ( Paying Guest Agreement )
Procure Revenue Documents ( Mutation )
Agreements/Deeds ( Gift Deed )
Affidavits ( Passport Affidavits )
Utility/Property Payments ( Property Tax Payment )
Lease/Rental Agreements ( Apartment Rental Agreement )
Registration Assistance ( Plot )
Construction Approvals ( Commercial )
Lease/Rental Agreements ( Leave And Licence )
Procure Revenue Documents ( Electricity Bill Name Transfer )
Agreements/Deeds ( Sale Agreement/Deed Review )
Legal Opinion (Written) ( Plots )
Affidavits ( Gas Affidavits )
Utility/Property Payments ( Electricity Bill Payment )
Lease/Rental Agreements ( House Rental agreement )
Registration Assistance ( Apartment )
Notary & Attestation Services ( Get A Document Notarised )
Lease/Rental Agreements ( NOC From Landlord )
Procure Revenue Documents ( Duplicate/Certified copy of sale deed )
Agreements/Deeds ( Construction Agreement Review )
Legal Opinion (Written) ( Apartment )
Affidavits ( General Affidavits )
Utility/Property Payments ( Water Bill Payment )
Lease/Rental Agreements ( Commercial Office Rental Agreement )
Registration Assistance ( Villas )
Notary & Attestation Services ( Gazetted Officer Attestation )
Lease/Rental Agreements ( Other Lease/Rental Agreements )
Procure Revenue Documents ( Certified copy of revenue document )
Agreements/Deeds ( Rectification Deed )
Legal Opinion (Written) ( Villas )
Affidavits ( Other Affidavits )
Power of Attorneys ( General Power of Attorney )
Lease/Rental Agreements ( Commercial Shop Rental Agreement )
Registration Assistance ( Independent House )
Notary & Attestation Services ( Tenant Police Verification )
Procure Revenue Documents ( Encumbrance Certificate )
Procure Revenue Documents ( Certified copy of registered GPA/SPA )
Agreements/Deeds ( Relinquishment deed )
Legal Opinion (Written) ( Independent House )
Property & Documents Inspection ( Plot/Site Insepction )
Power of Attorneys ( Special Power of Attorney )
Lease/Rental Agreements ( Commercial Lease Agreement )
Procure Revenue Documents ( Khata Extract )
Registration Assistance ( Agriculture Land )
e-stamp paper ( Get E-stamp paper )
Procure Revenue Documents ( Certified copy of registered documents )
Agreements/Deeds ( Mortgage Deed )
Legal Opinion (Written) ( Agriculture Land )
Property & Documents Inspection ( House/Apartment Inspection )
Power of Attorneys ( Revoke/cancel Power of Attorney )
Lease/Rental Agreements ( Residential Lease Agreement )
Procure Revenue Documents ( Khata Certificate )
Registration Assistance ( Commercial Property )
Procure Revenue Documents ( Other Revenue Documents )
Agreements/Deeds ( Exchange Deed )
Legal Opinion (Written) ( Commercial Property )
Property & Documents Inspection ( Documents Inspection in Govt Office )
Wills ( Make A will )
Lease/Rental Agreements ( Room Rental Agreement )
Procure Revenue Documents ( Khata Transfer )
Registration Assistance ( Revenue/Other Site )
Legal Opinion (Written) ( Revenue/Other Site )
Packages ( Legal Opinion to Registration (Plot/Site) )
Agreements/Deeds ( Release Deed )
Property & Documents Inspection ( Documents Inspection in Builder Office )
Wills ( Make A Codicil )
Lease/Rental Agreements ( Office Sharing Agreement )
Procure Revenue Documents ( Mother Deed Extract )
Agreements/Deeds ( Agreement of Sale )
Affidavits ( Name & Address Affidavits )
Packages ( Sale Agreement to Registration (Plot/Site) )
Agreements/Deeds ( Partition Deed )
Property & Documents Inspection ( Fraud & forgery Inspection )
Consultation on Property ( Property Buying )
Lease/Rental Agreements ( Car Parking Agreement )
Procure Revenue Documents ( Copy of Grant Certificate )
Agreements/Deeds ( Construction Agreement )
Affidavits ( Personal Affidavits )
Packages ( Sale Agreement to Registration (Apartment) )
Agreements/Deeds ( Memorandum of Understanding )
Property & Documents Inspection ( Agriculture Land Inspection )
Consultation on Property ( Property Selling )
Lease/Rental Agreements ( Settlement Of Rental Agreement )
Procure Revenue Documents ( Pahani/RTC )
Agreements/Deeds ( Sale deed )
Affidavits ( Student Affidavits )
Packages ( Legal Opinion to Registration (Apartment) )
Agreements/Deeds ( Joint Development Agreement )
NRI Services
Property Disputes ( Illegal Transfer of Land And Property )
Property Disputes ( Illegal occupation of Land and Property )
Investment/Realestate Claims ( Investment/Realestate Claims )
Buying Selling of Property in India ( Buying/Selling of Property in India )
Succession Certificate ( Succession Certificate )
Power of Attorneys for NRIs ( General Power of Attorney by NRI )
Power of Attorneys for NRIs ( Special Power of Attorney by NRI )
Property Search ( Land And Property Search )
Propert Transfer ( Land and Property Transfer )
Property Partition ( Partition of Land And Property )
Landlord Tenant Disputes ( Landlord Tenant Disputes )
Property Disputes ( Illegal Sale of Land And Property )
Realtors
RERA Consultation ( RERA Approved Agent )
RERA Consultation ( RERA Consultant )
RERA Consultation ( RERA Compliance Residential )
No Answers Found
