The breast is composed of several glands and ducts that lead to the nipple and the surrounding colored area called the areola effect of kamagra on woman
B Padmanabham
B Padmanabham @ Peasad
22 Years Exp
Revoke/cancel Power of Attorney (Show More)
Chittoor , Bhavani Nagar
View Answers by this Partner (0)
Profile Views : 46678
Information
Overview
Have you given a Power of attorney to someone you know? And later due to some reason you don’t want to continue the granting of power to the Attorney, or in situations where the Attorney is not ready to continue with the power granted by you, what should you do?
A Power of Attorney deed is always registered and made legal through proper stamp duty and registration process. Hence as long as the deed remains in the hands of the Attorney he is legally entitled to enjoy the powers granted in the deed. And the principal cannot cancel it orally. Cancellation of Power of Attorney is also known as Revocation of Power of Attorney in the legal language.
To revoke or cancel the Power of Attorney granted by the Principal and if registered, the same Principal (the person who granted the power) has to draft yet another Revocation Deed expressing his intention to cancel the earlier deed with effect from a particular date.
Revocation Deed is to be drafted in a proper format on a stamp paper of due value and has to be presented to the Registrar or sub- Registrar office where the earlier deed was registered. The Revocation Deed also has to be registered if the earlier Power of Attorney deed was registered.
You also have to send a written notice to the person to whom the power was granted, that is the Attorney, mentioning the cancellation of the deed from the date of notice. Otherwise if the Attorney comes to know of your intention before the notice is given to him, he may opt to do some mischief in case he has any crooked ideas.
If the Power of Attorney is not registered like the case of Special power of Attorney, where it is just made on a plain paper, and notarised, then a written notice to the Attorney mentioning the cancellation is enough.
What should be included in the deed?
The Revocation Deed should include the following:
The name of the Principal (the person who granted his powers to the Attorney) in the same spelling and format as in the earlier deed.
The date of the Power of Attorney deed that is now being cancelled.
The name of the Attorney in whose favour the power was granted in the earlier deed.
The date of the revocation or cancellation.
You can also elaborate on the nature of power that was given and the reason to revoke etc. though these are not mandatory.
Photos
Reviews
The primers used were p53 int1 fwd 5 CACAAAAACAGGTTAAACCCA 3 and p53 int10 rev 5 GAAGACAGAAAAGGGGAGGG 3; the composition of the PCR mix was as described above doxycycline before and after Cetirizine Zyrtec Pfizer, a histamine H 1 receptor antagonist, has been approved by the US Food and Drug Administration for treatment of seasonal allergic rhinitis, perennial allergic rhinitis and
Name : B Padmanabham @ Peasad
Law Firm Name : B Padmanabham
Country : India
City : Chittoor
State : ANDHRA PRADESH
Practicing Since: 2003
About Your Firm : Myself practising advocate since 2003 at Tirupati and Hyderabad.
| Sr Employee Associated | Sr Employee Enrollment/Reg.No | Sr Employee Enrollment/Reg.State |
|---|---|---|
| Jr Employee Associated | Jr Employee Enrollment/Reg.No | Jr Employee Enrollment/Reg.State |
Legal & Drafting
Utility/Property Payments ( Property Tax Payment )
Lease/Rental Agreements ( Apartment Rental Agreement )
Affidavits ( Passport Affidavits )
Registration Assistance ( Plot )
Construction Approvals ( Commercial )
Lease/Rental Agreements ( Leave And Licence )
Procure Revenue Documents ( Electricity Bill Name Transfer )
Agreements/Deeds ( Sale Agreement/Deed Review )
Legal Opinion (Written) ( Plots )
Utility/Property Payments ( Electricity Bill Payment )
Lease/Rental Agreements ( House Rental agreement )
Affidavits ( Gas Affidavits )
Registration Assistance ( Apartment )
Notary & Attestation Services ( Get A Document Notarised )
Lease/Rental Agreements ( NOC From Landlord )
Procure Revenue Documents ( Duplicate/Certified copy of sale deed )
Agreements/Deeds ( Construction Agreement Review )
Legal Opinion (Written) ( Apartment )
Affidavits ( General Affidavits )
Utility/Property Payments ( Water Bill Payment )
Lease/Rental Agreements ( Commercial Office Rental Agreement )
Registration Assistance ( Villas )
Notary & Attestation Services ( Gazetted Officer Attestation )
Lease/Rental Agreements ( Other Lease/Rental Agreements )
Procure Revenue Documents ( Certified copy of revenue document )
Agreements/Deeds ( Rectification Deed )
Legal Opinion (Written) ( Villas )
Affidavits ( Other Affidavits )
Power of Attorneys ( General Power of Attorney )
Lease/Rental Agreements ( Commercial Shop Rental Agreement )
Registration Assistance ( Independent House )
Notary & Attestation Services ( Tenant Police Verification )
Procure Revenue Documents ( Encumbrance Certificate )
Procure Revenue Documents ( Certified copy of registered GPA/SPA )
Agreements/Deeds ( Relinquishment deed )
Legal Opinion (Written) ( Independent House )
Property & Documents Inspection ( Plot/Site Insepction )
Power of Attorneys ( Special Power of Attorney )
Lease/Rental Agreements ( Commercial Lease Agreement )
Registration Assistance ( Agriculture Land )
e-stamp paper ( Get E-stamp paper )
Procure Revenue Documents ( Khata Extract )
Procure Revenue Documents ( Certified copy of registered documents )
Agreements/Deeds ( Mortgage Deed )
Legal Opinion (Written) ( Agriculture Land )
Property & Documents Inspection ( House/Apartment Inspection )
Power of Attorneys ( Revoke/cancel Power of Attorney )
Lease/Rental Agreements ( Residential Lease Agreement )
Registration Assistance ( Commercial Property )
Procure Revenue Documents ( Khata Certificate )
Procure Revenue Documents ( Other Revenue Documents )
Agreements/Deeds ( Exchange Deed )
Legal Opinion (Written) ( Commercial Property )
Property & Documents Inspection ( Documents Inspection in Govt Office )
Wills ( Make A will )
Lease/Rental Agreements ( Room Rental Agreement )
Registration Assistance ( Revenue/Other Site )
Procure Revenue Documents ( Khata Transfer )
Packages ( Legal Opinion to Registration (Plot/Site) )
Agreements/Deeds ( Release Deed )
Legal Opinion (Written) ( Revenue/Other Site )
Property & Documents Inspection ( Documents Inspection in Builder Office )
Wills ( Make A Codicil )
Lease/Rental Agreements ( Office Sharing Agreement )
Agreements/Deeds ( Agreement of Sale )
Procure Revenue Documents ( Mother Deed Extract )
Packages ( Sale Agreement to Registration (Plot/Site) )
Agreements/Deeds ( Partition Deed )
Affidavits ( Name & Address Affidavits )
Property & Documents Inspection ( Fraud & forgery Inspection )
Consultation on Property ( Property Buying )
Lease/Rental Agreements ( Car Parking Agreement )
Agreements/Deeds ( Construction Agreement )
Procure Revenue Documents ( Copy of Grant Certificate )
Packages ( Sale Agreement to Registration (Apartment) )
Agreements/Deeds ( Memorandum of Understanding )
Affidavits ( Personal Affidavits )
Property & Documents Inspection ( Agriculture Land Inspection )
Consultation on Property ( Property Selling )
Lease/Rental Agreements ( Settlement Of Rental Agreement )
Procure Revenue Documents ( Pahani/RTC )
Agreements/Deeds ( Sale deed )
Packages ( Legal Opinion to Registration (Apartment) )
Agreements/Deeds ( Joint Development Agreement )
Affidavits ( Student Affidavits )
Property & Documents Inspection ( Industrial / Commercial Inspection )
Construction Approvals ( Residential )
Lease/Rental Agreements ( Paying Guest Agreement )
Procure Revenue Documents ( Mutation )
Agreements/Deeds ( Gift Deed )
NRI Services
Property Disputes ( Illegal occupation of Land and Property )
Buying Selling of Property in India ( Buying/Selling of Property in India )
Investment/Realestate Claims ( Investment/Realestate Claims )
Property Search ( Land And Property Search )
Succession Certificate ( Succession Certificate )
Propert Transfer ( Land and Property Transfer )
Power of Attorneys for NRIs ( General Power of Attorney by NRI )
Property Partition ( Partition of Land And Property )
Power of Attorneys for NRIs ( Special Power of Attorney by NRI )
Landlord Tenant Disputes ( Landlord Tenant Disputes )
Property Disputes ( Illegal Sale of Land And Property )
Property Disputes ( Illegal Transfer of Land And Property )
Realtors
RERA Consultation ( RERA Compliance Residential )
RERA Consultation ( RERA Approved Agent )
RERA Consultation ( RERA Consultant )
No Answers Found
