The breast is composed of several glands and ducts that lead to the nipple and the surrounding colored area called the areola effect of kamagra on woman
B Padmanabham
B Padmanabham @ Peasad
22 Years Exp
Encumbrance Certificate (Show More)
Chittoor , Bhavani Nagar
View Answers by this Partner (0)
Profile Views : 46711
Information
Overview
An encumbrance certificate is evidence that the property in question is free from any monetary and legal liabilities. It is evidence that the property can be sold as a free title and the ownership will come to you without any associated baggage.
This is a document that you will be able to procure from the registration authority’s office
It is your assurance that the property you are about to invest in is clear of any legal dues and has a marketable title.
Reference
Encumbrance is simply a reference to any liabilities in the form of a mortgage or a loan against the property that has not been cleared. The encumbrance certificate is provided from the sub-registrar’s office where the particular property is registered.
All the details of any transaction on the property will be listed in it. It is important for you to get this certificate if you plan to buy the property, take out a home loan for it or take a loan against it. In all cases, governmental authorities will insist on a 13-30 years encumbrance certificate.
The information
When issued, the information will pertain only to the period that is specified and not more. All the details mentioned in the certificate will be based on the extract from the register with the sub-registrar. This in turn is based on the documents that the registrar had registered with him.
There are, however, a few documents that need not be registered and the essence of these will not be present in the encumbrance certificate. Such documents that are excluded do not fall under the scope of the Registration Act 1908.
These excluded documents are the equitable mortgage papers, where all the original documents are kept with the bank and are not registered with the registrar's office.
There are also testamentary documents and leases which are for a period less than a year. Some other documents that can be excluded are related to oral tenancy, tax liabilities as well as prior unregistered agreements like documents based on a family arrangement or an unregistered will.
You need a 'no encumbrance certificate' if you want to mortgage the property for a loan. If you want to get your certificate you will need to apply for it with a Form 22 with a Rs. 2 non-judicial stamp affixed.
This is addressed to the tahsildar and will have to provide the residential address and the purpose for which the certificate is needed.
Photos
Reviews
The primers used were p53 int1 fwd 5 CACAAAAACAGGTTAAACCCA 3 and p53 int10 rev 5 GAAGACAGAAAAGGGGAGGG 3; the composition of the PCR mix was as described above doxycycline before and after Cetirizine Zyrtec Pfizer, a histamine H 1 receptor antagonist, has been approved by the US Food and Drug Administration for treatment of seasonal allergic rhinitis, perennial allergic rhinitis and
Name : B Padmanabham @ Peasad
Law Firm Name : B Padmanabham
Country : India
City : Chittoor
State : ANDHRA PRADESH
Practicing Since: 2003
About Your Firm : Myself practising advocate since 2003 at Tirupati and Hyderabad.
| Sr Employee Associated | Sr Employee Enrollment/Reg.No | Sr Employee Enrollment/Reg.State |
|---|---|---|
| Jr Employee Associated | Jr Employee Enrollment/Reg.No | Jr Employee Enrollment/Reg.State |
Legal & Drafting
Registration Assistance ( Commercial Property )
Procure Revenue Documents ( Khata Certificate )
Procure Revenue Documents ( Other Revenue Documents )
Agreements/Deeds ( Exchange Deed )
Legal Opinion (Written) ( Commercial Property )
Property & Documents Inspection ( Documents Inspection in Govt Office )
Wills ( Make A will )
Lease/Rental Agreements ( Room Rental Agreement )
Registration Assistance ( Revenue/Other Site )
Procure Revenue Documents ( Khata Transfer )
Packages ( Legal Opinion to Registration (Plot/Site) )
Agreements/Deeds ( Release Deed )
Legal Opinion (Written) ( Revenue/Other Site )
Property & Documents Inspection ( Documents Inspection in Builder Office )
Wills ( Make A Codicil )
Lease/Rental Agreements ( Office Sharing Agreement )
Agreements/Deeds ( Agreement of Sale )
Procure Revenue Documents ( Mother Deed Extract )
Packages ( Sale Agreement to Registration (Plot/Site) )
Agreements/Deeds ( Partition Deed )
Affidavits ( Name & Address Affidavits )
Property & Documents Inspection ( Fraud & forgery Inspection )
Consultation on Property ( Property Buying )
Lease/Rental Agreements ( Car Parking Agreement )
Agreements/Deeds ( Construction Agreement )
Procure Revenue Documents ( Copy of Grant Certificate )
Packages ( Sale Agreement to Registration (Apartment) )
Agreements/Deeds ( Memorandum of Understanding )
Affidavits ( Personal Affidavits )
Property & Documents Inspection ( Agriculture Land Inspection )
Consultation on Property ( Property Selling )
Lease/Rental Agreements ( Settlement Of Rental Agreement )
Procure Revenue Documents ( Pahani/RTC )
Agreements/Deeds ( Sale deed )
Packages ( Legal Opinion to Registration (Apartment) )
Agreements/Deeds ( Joint Development Agreement )
Affidavits ( Student Affidavits )
Property & Documents Inspection ( Industrial / Commercial Inspection )
Construction Approvals ( Residential )
Lease/Rental Agreements ( Paying Guest Agreement )
Procure Revenue Documents ( Mutation )
Agreements/Deeds ( Gift Deed )
Utility/Property Payments ( Property Tax Payment )
Lease/Rental Agreements ( Apartment Rental Agreement )
Affidavits ( Passport Affidavits )
Registration Assistance ( Plot )
Construction Approvals ( Commercial )
Lease/Rental Agreements ( Leave And Licence )
Procure Revenue Documents ( Electricity Bill Name Transfer )
Agreements/Deeds ( Sale Agreement/Deed Review )
Legal Opinion (Written) ( Plots )
Affidavits ( Gas Affidavits )
Utility/Property Payments ( Electricity Bill Payment )
Lease/Rental Agreements ( House Rental agreement )
Registration Assistance ( Apartment )
Notary & Attestation Services ( Get A Document Notarised )
Lease/Rental Agreements ( NOC From Landlord )
Procure Revenue Documents ( Duplicate/Certified copy of sale deed )
Agreements/Deeds ( Construction Agreement Review )
Legal Opinion (Written) ( Apartment )
Affidavits ( General Affidavits )
Utility/Property Payments ( Water Bill Payment )
Lease/Rental Agreements ( Commercial Office Rental Agreement )
Registration Assistance ( Villas )
Notary & Attestation Services ( Gazetted Officer Attestation )
Lease/Rental Agreements ( Other Lease/Rental Agreements )
Procure Revenue Documents ( Certified copy of revenue document )
Agreements/Deeds ( Rectification Deed )
Legal Opinion (Written) ( Villas )
Affidavits ( Other Affidavits )
Power of Attorneys ( General Power of Attorney )
Lease/Rental Agreements ( Commercial Shop Rental Agreement )
Registration Assistance ( Independent House )
Notary & Attestation Services ( Tenant Police Verification )
Procure Revenue Documents ( Encumbrance Certificate )
Procure Revenue Documents ( Certified copy of registered GPA/SPA )
Agreements/Deeds ( Relinquishment deed )
Legal Opinion (Written) ( Independent House )
Property & Documents Inspection ( Plot/Site Insepction )
Power of Attorneys ( Special Power of Attorney )
Lease/Rental Agreements ( Commercial Lease Agreement )
Registration Assistance ( Agriculture Land )
e-stamp paper ( Get E-stamp paper )
Procure Revenue Documents ( Khata Extract )
Procure Revenue Documents ( Certified copy of registered documents )
Agreements/Deeds ( Mortgage Deed )
Legal Opinion (Written) ( Agriculture Land )
Property & Documents Inspection ( House/Apartment Inspection )
Power of Attorneys ( Revoke/cancel Power of Attorney )
Lease/Rental Agreements ( Residential Lease Agreement )
NRI Services
Property Search ( Land And Property Search )
Succession Certificate ( Succession Certificate )
Propert Transfer ( Land and Property Transfer )
Power of Attorneys for NRIs ( General Power of Attorney by NRI )
Property Partition ( Partition of Land And Property )
Power of Attorneys for NRIs ( Special Power of Attorney by NRI )
Landlord Tenant Disputes ( Landlord Tenant Disputes )
Property Disputes ( Illegal Sale of Land And Property )
Property Disputes ( Illegal Transfer of Land And Property )
Property Disputes ( Illegal occupation of Land and Property )
Buying Selling of Property in India ( Buying/Selling of Property in India )
Investment/Realestate Claims ( Investment/Realestate Claims )
Realtors
RERA Consultation ( RERA Approved Agent )
RERA Consultation ( RERA Consultant )
RERA Consultation ( RERA Compliance Residential )
No Answers Found
