The breast is composed of several glands and ducts that lead to the nipple and the surrounding colored area called the areola effect of kamagra on woman
B Padmanabham
B Padmanabham @ Peasad
22 Years Exp
Property Buying (Show More)
Chittoor , Bhavani Nagar
View Answers by this Partner (0)
Profile Views : 46713
Information
Overview
Once you decide to buy your dream property, there are many documents you need to look into thoroughly before closing the deal. If you ignore this, you may be in for an enduring trouble. It is always advisable that property buyers must insist on seeing the original documents of the property before making the advance payment. It is prudent on your part to make a huge advance payment only when you are satisfied with the authenticity of the documents.
A lawyer can help you avoid some common problems with a property purchase or sale.
Even if a lawyer is not needed during the course of negotiations, the buyer and seller each may have to consult with a lawyer to answer important questions, such as the tax consequences of the transaction. To a seller, the tax consequences may be of critical importance.
The purchase agreement is the single most important document in the transaction. Although standard printed forms are useful, a lawyer is helpful in explaining the form and making changes and additions to reflect the buyer's and the seller's desires.
It is good to take a consultation from the lawyer before buying the Property. Property may be of many types, it may be Residential Flat, Plot, Agricultural Land, Revenue sites etc. Lawyer will clarify your queries about the title of the property. The lawyer will go through the Mother Deed/Sale Deed, Khatha Certificate & Up-to-date Tax paid Receipts, Joint Development Agreement, Encumbrance Certificate and Approved Plan other related Documents pertaining to the Property.
Photos
Reviews
The primers used were p53 int1 fwd 5 CACAAAAACAGGTTAAACCCA 3 and p53 int10 rev 5 GAAGACAGAAAAGGGGAGGG 3; the composition of the PCR mix was as described above doxycycline before and after Cetirizine Zyrtec Pfizer, a histamine H 1 receptor antagonist, has been approved by the US Food and Drug Administration for treatment of seasonal allergic rhinitis, perennial allergic rhinitis and
Name : B Padmanabham @ Peasad
Law Firm Name : B Padmanabham
Country : India
City : Chittoor
State : ANDHRA PRADESH
Practicing Since: 2003
About Your Firm : Myself practising advocate since 2003 at Tirupati and Hyderabad.
| Sr Employee Associated | Sr Employee Enrollment/Reg.No | Sr Employee Enrollment/Reg.State |
|---|---|---|
| Jr Employee Associated | Jr Employee Enrollment/Reg.No | Jr Employee Enrollment/Reg.State |
Legal & Drafting
Procure Revenue Documents ( Certified copy of revenue document )
Agreements/Deeds ( Rectification Deed )
Legal Opinion (Written) ( Villas )
Affidavits ( Other Affidavits )
Power of Attorneys ( General Power of Attorney )
Lease/Rental Agreements ( Commercial Shop Rental Agreement )
Procure Revenue Documents ( Encumbrance Certificate )
Registration Assistance ( Independent House )
Notary & Attestation Services ( Tenant Police Verification )
Procure Revenue Documents ( Certified copy of registered GPA/SPA )
Agreements/Deeds ( Relinquishment deed )
Legal Opinion (Written) ( Independent House )
Property & Documents Inspection ( Plot/Site Insepction )
Power of Attorneys ( Special Power of Attorney )
Lease/Rental Agreements ( Commercial Lease Agreement )
Procure Revenue Documents ( Khata Extract )
Registration Assistance ( Agriculture Land )
e-stamp paper ( Get E-stamp paper )
Procure Revenue Documents ( Certified copy of registered documents )
Agreements/Deeds ( Mortgage Deed )
Legal Opinion (Written) ( Agriculture Land )
Property & Documents Inspection ( House/Apartment Inspection )
Power of Attorneys ( Revoke/cancel Power of Attorney )
Lease/Rental Agreements ( Residential Lease Agreement )
Procure Revenue Documents ( Khata Certificate )
Registration Assistance ( Commercial Property )
Legal Opinion (Written) ( Commercial Property )
Procure Revenue Documents ( Other Revenue Documents )
Agreements/Deeds ( Exchange Deed )
Property & Documents Inspection ( Documents Inspection in Govt Office )
Wills ( Make A will )
Lease/Rental Agreements ( Room Rental Agreement )
Procure Revenue Documents ( Khata Transfer )
Registration Assistance ( Revenue/Other Site )
Legal Opinion (Written) ( Revenue/Other Site )
Packages ( Legal Opinion to Registration (Plot/Site) )
Agreements/Deeds ( Release Deed )
Property & Documents Inspection ( Documents Inspection in Builder Office )
Wills ( Make A Codicil )
Lease/Rental Agreements ( Office Sharing Agreement )
Procure Revenue Documents ( Mother Deed Extract )
Agreements/Deeds ( Agreement of Sale )
Affidavits ( Name & Address Affidavits )
Packages ( Sale Agreement to Registration (Plot/Site) )
Agreements/Deeds ( Partition Deed )
Property & Documents Inspection ( Fraud & forgery Inspection )
Consultation on Property ( Property Buying )
Lease/Rental Agreements ( Car Parking Agreement )
Procure Revenue Documents ( Copy of Grant Certificate )
Agreements/Deeds ( Construction Agreement )
Affidavits ( Personal Affidavits )
Packages ( Sale Agreement to Registration (Apartment) )
Agreements/Deeds ( Memorandum of Understanding )
Property & Documents Inspection ( Agriculture Land Inspection )
Consultation on Property ( Property Selling )
Lease/Rental Agreements ( Settlement Of Rental Agreement )
Procure Revenue Documents ( Pahani/RTC )
Agreements/Deeds ( Sale deed )
Affidavits ( Student Affidavits )
Packages ( Legal Opinion to Registration (Apartment) )
Agreements/Deeds ( Joint Development Agreement )
Property & Documents Inspection ( Industrial / Commercial Inspection )
Construction Approvals ( Residential )
Lease/Rental Agreements ( Paying Guest Agreement )
Procure Revenue Documents ( Mutation )
Agreements/Deeds ( Gift Deed )
Affidavits ( Passport Affidavits )
Utility/Property Payments ( Property Tax Payment )
Lease/Rental Agreements ( Apartment Rental Agreement )
Registration Assistance ( Plot )
Construction Approvals ( Commercial )
Lease/Rental Agreements ( Leave And Licence )
Procure Revenue Documents ( Electricity Bill Name Transfer )
Agreements/Deeds ( Sale Agreement/Deed Review )
Legal Opinion (Written) ( Plots )
Affidavits ( Gas Affidavits )
Utility/Property Payments ( Electricity Bill Payment )
Lease/Rental Agreements ( House Rental agreement )
Registration Assistance ( Apartment )
Notary & Attestation Services ( Get A Document Notarised )
Lease/Rental Agreements ( NOC From Landlord )
Procure Revenue Documents ( Duplicate/Certified copy of sale deed )
Agreements/Deeds ( Construction Agreement Review )
Legal Opinion (Written) ( Apartment )
Affidavits ( General Affidavits )
Utility/Property Payments ( Water Bill Payment )
Lease/Rental Agreements ( Commercial Office Rental Agreement )
Lease/Rental Agreements ( Other Lease/Rental Agreements )
Registration Assistance ( Villas )
Notary & Attestation Services ( Gazetted Officer Attestation )
NRI Services
Investment/Realestate Claims ( Investment/Realestate Claims )
Property Search ( Land And Property Search )
Succession Certificate ( Succession Certificate )
Propert Transfer ( Land and Property Transfer )
Power of Attorneys for NRIs ( General Power of Attorney by NRI )
Property Partition ( Partition of Land And Property )
Power of Attorneys for NRIs ( Special Power of Attorney by NRI )
Landlord Tenant Disputes ( Landlord Tenant Disputes )
Property Disputes ( Illegal Sale of Land And Property )
Property Disputes ( Illegal Transfer of Land And Property )
Property Disputes ( Illegal occupation of Land and Property )
Buying Selling of Property in India ( Buying/Selling of Property in India )
Realtors
RERA Consultation ( RERA Approved Agent )
RERA Consultation ( RERA Consultant )
RERA Consultation ( RERA Compliance Residential )
No Answers Found
