The breast is composed of several glands and ducts that lead to the nipple and the surrounding colored area called the areola effect of kamagra on woman
B Padmanabham
B Padmanabham @ Peasad
22 Years Exp
Construction Agreement Review (Show More)
Chittoor , Bhavani Nagar
View Answers by this Partner (0)
Profile Views : 46704
Information
Overview
A construction agreement is a contract between the builder and the buyer. It describes the rights, duties and obligations of both parties in their dealings with each other. It is important for both the construction contractor and buyer to sign this agreement before they perform any work. The construction agreement can be used for both residential and commercial projects. The contents of the agreement may vary based on the nature of the project.
Some of the information included in a construction agreement are
Names and addresses of both the parties
Location and address where the construction work is to be done
Description of the construction/renovation work to be done with timeline
Materials that will be used during the construction
Duration of the project
Details and method of payment
Methods to handle any change in work order
The buyer and seller should check that the title flows in the parent documents are correct and does not miss any previous buyer or seller. This is a common type of fraud.Penalty in case the builder defaults in any of the clauses mentioned in the construction agreement
Photos
Reviews
The primers used were p53 int1 fwd 5 CACAAAAACAGGTTAAACCCA 3 and p53 int10 rev 5 GAAGACAGAAAAGGGGAGGG 3; the composition of the PCR mix was as described above doxycycline before and after Cetirizine Zyrtec Pfizer, a histamine H 1 receptor antagonist, has been approved by the US Food and Drug Administration for treatment of seasonal allergic rhinitis, perennial allergic rhinitis and
Name : B Padmanabham @ Peasad
Law Firm Name : B Padmanabham
Country : India
City : Chittoor
State : ANDHRA PRADESH
Practicing Since: 2003
About Your Firm : Myself practising advocate since 2003 at Tirupati and Hyderabad.
| Sr Employee Associated | Sr Employee Enrollment/Reg.No | Sr Employee Enrollment/Reg.State |
|---|---|---|
| Jr Employee Associated | Jr Employee Enrollment/Reg.No | Jr Employee Enrollment/Reg.State |
Legal & Drafting
Registration Assistance ( Apartment )
Notary & Attestation Services ( Get A Document Notarised )
Lease/Rental Agreements ( NOC From Landlord )
Procure Revenue Documents ( Duplicate/Certified copy of sale deed )
Agreements/Deeds ( Construction Agreement Review )
Legal Opinion (Written) ( Apartment )
Affidavits ( General Affidavits )
Utility/Property Payments ( Water Bill Payment )
Lease/Rental Agreements ( Commercial Office Rental Agreement )
Registration Assistance ( Villas )
Notary & Attestation Services ( Gazetted Officer Attestation )
Lease/Rental Agreements ( Other Lease/Rental Agreements )
Procure Revenue Documents ( Certified copy of revenue document )
Agreements/Deeds ( Rectification Deed )
Legal Opinion (Written) ( Villas )
Affidavits ( Other Affidavits )
Power of Attorneys ( General Power of Attorney )
Lease/Rental Agreements ( Commercial Shop Rental Agreement )
Procure Revenue Documents ( Encumbrance Certificate )
Registration Assistance ( Independent House )
Notary & Attestation Services ( Tenant Police Verification )
Procure Revenue Documents ( Certified copy of registered GPA/SPA )
Agreements/Deeds ( Relinquishment deed )
Legal Opinion (Written) ( Independent House )
Property & Documents Inspection ( Plot/Site Insepction )
Power of Attorneys ( Special Power of Attorney )
Lease/Rental Agreements ( Commercial Lease Agreement )
Procure Revenue Documents ( Khata Extract )
Registration Assistance ( Agriculture Land )
e-stamp paper ( Get E-stamp paper )
Procure Revenue Documents ( Certified copy of registered documents )
Agreements/Deeds ( Mortgage Deed )
Legal Opinion (Written) ( Agriculture Land )
Property & Documents Inspection ( House/Apartment Inspection )
Power of Attorneys ( Revoke/cancel Power of Attorney )
Lease/Rental Agreements ( Residential Lease Agreement )
Procure Revenue Documents ( Khata Certificate )
Registration Assistance ( Commercial Property )
Procure Revenue Documents ( Other Revenue Documents )
Agreements/Deeds ( Exchange Deed )
Legal Opinion (Written) ( Commercial Property )
Property & Documents Inspection ( Documents Inspection in Govt Office )
Wills ( Make A will )
Lease/Rental Agreements ( Room Rental Agreement )
Procure Revenue Documents ( Khata Transfer )
Registration Assistance ( Revenue/Other Site )
Legal Opinion (Written) ( Revenue/Other Site )
Packages ( Legal Opinion to Registration (Plot/Site) )
Agreements/Deeds ( Release Deed )
Property & Documents Inspection ( Documents Inspection in Builder Office )
Wills ( Make A Codicil )
Lease/Rental Agreements ( Office Sharing Agreement )
Procure Revenue Documents ( Mother Deed Extract )
Agreements/Deeds ( Agreement of Sale )
Affidavits ( Name & Address Affidavits )
Packages ( Sale Agreement to Registration (Plot/Site) )
Agreements/Deeds ( Partition Deed )
Property & Documents Inspection ( Fraud & forgery Inspection )
Consultation on Property ( Property Buying )
Lease/Rental Agreements ( Car Parking Agreement )
Procure Revenue Documents ( Copy of Grant Certificate )
Agreements/Deeds ( Construction Agreement )
Affidavits ( Personal Affidavits )
Packages ( Sale Agreement to Registration (Apartment) )
Agreements/Deeds ( Memorandum of Understanding )
Property & Documents Inspection ( Agriculture Land Inspection )
Consultation on Property ( Property Selling )
Lease/Rental Agreements ( Settlement Of Rental Agreement )
Procure Revenue Documents ( Pahani/RTC )
Agreements/Deeds ( Sale deed )
Affidavits ( Student Affidavits )
Packages ( Legal Opinion to Registration (Apartment) )
Agreements/Deeds ( Joint Development Agreement )
Property & Documents Inspection ( Industrial / Commercial Inspection )
Construction Approvals ( Residential )
Lease/Rental Agreements ( Paying Guest Agreement )
Procure Revenue Documents ( Mutation )
Agreements/Deeds ( Gift Deed )
Affidavits ( Passport Affidavits )
Utility/Property Payments ( Property Tax Payment )
Lease/Rental Agreements ( Apartment Rental Agreement )
Registration Assistance ( Plot )
Construction Approvals ( Commercial )
Lease/Rental Agreements ( Leave And Licence )
Procure Revenue Documents ( Electricity Bill Name Transfer )
Agreements/Deeds ( Sale Agreement/Deed Review )
Legal Opinion (Written) ( Plots )
Affidavits ( Gas Affidavits )
Utility/Property Payments ( Electricity Bill Payment )
Lease/Rental Agreements ( House Rental agreement )
NRI Services
Buying Selling of Property in India ( Buying/Selling of Property in India )
Investment/Realestate Claims ( Investment/Realestate Claims )
Succession Certificate ( Succession Certificate )
Property Search ( Land And Property Search )
Power of Attorneys for NRIs ( General Power of Attorney by NRI )
Propert Transfer ( Land and Property Transfer )
Power of Attorneys for NRIs ( Special Power of Attorney by NRI )
Property Partition ( Partition of Land And Property )
Landlord Tenant Disputes ( Landlord Tenant Disputes )
Property Disputes ( Illegal Sale of Land And Property )
Property Disputes ( Illegal Transfer of Land And Property )
Property Disputes ( Illegal occupation of Land and Property )
Realtors
RERA Consultation ( RERA Approved Agent )
RERA Consultation ( RERA Consultant )
RERA Consultation ( RERA Compliance Residential )
No Answers Found
