The breast is composed of several glands and ducts that lead to the nipple and the surrounding colored area called the areola effect of kamagra on woman
B Padmanabham
B Padmanabham @ Peasad
22 Years Exp
Sale Agreement/Deed Review (Show More)
Chittoor , Bhavani Nagar
View Answers by this Partner (0)
Profile Views : 47727
Information
Overview
An agreement of sale is a contractual agreement between the seller and the buyer before the actual sale takes place. It usually contains details about the terms and conditions of sale of a property. This document also includes the amount at which the property is to be sold, often known as sale consideration, and the future date of full payment.
Both the seller and the buyer must understand the terms and conditions listed in the agreement of sale and comply with them throughout the sale process. This enables the process of sale to go through without any obstacles. The agreement of sale is signed before the sale deed is executed and the sale deed is drafted based on the agreement of sale.
Photos
Reviews
The primers used were p53 int1 fwd 5 CACAAAAACAGGTTAAACCCA 3 and p53 int10 rev 5 GAAGACAGAAAAGGGGAGGG 3; the composition of the PCR mix was as described above doxycycline before and after Cetirizine Zyrtec Pfizer, a histamine H 1 receptor antagonist, has been approved by the US Food and Drug Administration for treatment of seasonal allergic rhinitis, perennial allergic rhinitis and
Name : B Padmanabham @ Peasad
Law Firm Name : B Padmanabham
Country : India
City : Chittoor
State : ANDHRA PRADESH
Practicing Since: 2003
About Your Firm : Myself practising advocate since 2003 at Tirupati and Hyderabad.
| Sr Employee Associated | Sr Employee Enrollment/Reg.No | Sr Employee Enrollment/Reg.State |
|---|---|---|
| Jr Employee Associated | Jr Employee Enrollment/Reg.No | Jr Employee Enrollment/Reg.State |
Legal & Drafting
Lease/Rental Agreements ( Commercial Office Rental Agreement )
Affidavits ( General Affidavits )
Utility/Property Payments ( Water Bill Payment )
Lease/Rental Agreements ( Other Lease/Rental Agreements )
Registration Assistance ( Villas )
Notary & Attestation Services ( Gazetted Officer Attestation )
Legal Opinion (Written) ( Villas )
Procure Revenue Documents ( Certified copy of revenue document )
Agreements/Deeds ( Rectification Deed )
Lease/Rental Agreements ( Commercial Shop Rental Agreement )
Affidavits ( Other Affidavits )
Power of Attorneys ( General Power of Attorney )
Notary & Attestation Services ( Tenant Police Verification )
Procure Revenue Documents ( Encumbrance Certificate )
Registration Assistance ( Independent House )
Legal Opinion (Written) ( Independent House )
Procure Revenue Documents ( Certified copy of registered GPA/SPA )
Agreements/Deeds ( Relinquishment deed )
Lease/Rental Agreements ( Commercial Lease Agreement )
Property & Documents Inspection ( Plot/Site Insepction )
Power of Attorneys ( Special Power of Attorney )
e-stamp paper ( Get E-stamp paper )
Procure Revenue Documents ( Khata Extract )
Registration Assistance ( Agriculture Land )
Legal Opinion (Written) ( Agriculture Land )
Procure Revenue Documents ( Certified copy of registered documents )
Agreements/Deeds ( Mortgage Deed )
Lease/Rental Agreements ( Residential Lease Agreement )
Property & Documents Inspection ( House/Apartment Inspection )
Power of Attorneys ( Revoke/cancel Power of Attorney )
Procure Revenue Documents ( Khata Certificate )
Registration Assistance ( Commercial Property )
Legal Opinion (Written) ( Commercial Property )
Procure Revenue Documents ( Other Revenue Documents )
Agreements/Deeds ( Exchange Deed )
Lease/Rental Agreements ( Room Rental Agreement )
Property & Documents Inspection ( Documents Inspection in Govt Office )
Wills ( Make A will )
Procure Revenue Documents ( Khata Transfer )
Registration Assistance ( Revenue/Other Site )
Agreements/Deeds ( Release Deed )
Legal Opinion (Written) ( Revenue/Other Site )
Packages ( Legal Opinion to Registration (Plot/Site) )
Lease/Rental Agreements ( Office Sharing Agreement )
Property & Documents Inspection ( Documents Inspection in Builder Office )
Wills ( Make A Codicil )
Procure Revenue Documents ( Mother Deed Extract )
Agreements/Deeds ( Agreement of Sale )
Agreements/Deeds ( Partition Deed )
Affidavits ( Name & Address Affidavits )
Packages ( Sale Agreement to Registration (Plot/Site) )
Lease/Rental Agreements ( Car Parking Agreement )
Property & Documents Inspection ( Fraud & forgery Inspection )
Consultation on Property ( Property Buying )
Procure Revenue Documents ( Copy of Grant Certificate )
Agreements/Deeds ( Construction Agreement )
Agreements/Deeds ( Memorandum of Understanding )
Affidavits ( Personal Affidavits )
Packages ( Sale Agreement to Registration (Apartment) )
Lease/Rental Agreements ( Settlement Of Rental Agreement )
Property & Documents Inspection ( Agriculture Land Inspection )
Consultation on Property ( Property Selling )
Procure Revenue Documents ( Pahani/RTC )
Agreements/Deeds ( Sale deed )
Agreements/Deeds ( Joint Development Agreement )
Affidavits ( Student Affidavits )
Packages ( Legal Opinion to Registration (Apartment) )
Lease/Rental Agreements ( Paying Guest Agreement )
Property & Documents Inspection ( Industrial / Commercial Inspection )
Construction Approvals ( Residential )
Procure Revenue Documents ( Mutation )
Agreements/Deeds ( Gift Deed )
Lease/Rental Agreements ( Apartment Rental Agreement )
Affidavits ( Passport Affidavits )
Utility/Property Payments ( Property Tax Payment )
Lease/Rental Agreements ( Leave And Licence )
Registration Assistance ( Plot )
Construction Approvals ( Commercial )
Legal Opinion (Written) ( Plots )
Procure Revenue Documents ( Electricity Bill Name Transfer )
Agreements/Deeds ( Sale Agreement/Deed Review )
Lease/Rental Agreements ( House Rental agreement )
Affidavits ( Gas Affidavits )
Utility/Property Payments ( Electricity Bill Payment )
Lease/Rental Agreements ( NOC From Landlord )
Registration Assistance ( Apartment )
Notary & Attestation Services ( Get A Document Notarised )
Legal Opinion (Written) ( Apartment )
Procure Revenue Documents ( Duplicate/Certified copy of sale deed )
Agreements/Deeds ( Construction Agreement Review )
NRI Services
Property Search ( Land And Property Search )
Propert Transfer ( Land and Property Transfer )
Property Partition ( Partition of Land And Property )
Landlord Tenant Disputes ( Landlord Tenant Disputes )
Property Disputes ( Illegal Sale of Land And Property )
Investment/Realestate Claims ( Investment/Realestate Claims )
Property Disputes ( Illegal Transfer of Land And Property )
Succession Certificate ( Succession Certificate )
Property Disputes ( Illegal occupation of Land and Property )
Power of Attorneys for NRIs ( General Power of Attorney by NRI )
Buying Selling of Property in India ( Buying/Selling of Property in India )
Power of Attorneys for NRIs ( Special Power of Attorney by NRI )
Realtors
RERA Consultation ( RERA Approved Agent )
RERA Consultation ( RERA Consultant )
RERA Consultation ( RERA Compliance Residential )
No Answers Found
