The breast is composed of several glands and ducts that lead to the nipple and the surrounding colored area called the areola effect of kamagra on woman
B Padmanabham
B Padmanabham @ Peasad
22 Years Exp
RERA Consultant (Show More)
Chittoor , Bhavani Nagar
View Answers by this Partner (0)
Profile Views : 47694
Information
Overview
Promoters are the builders or the developers who builds apartment buildings and sell those to home seekers. With increasing complaints against the promoters, the Real Estate Regulatory Act notification by the government of India has led multiple guidelines which the promoters have to meet so as to legally build a project or sell it. The complaints of the buyers that have increased in the last decade or so have been mainly about the late possession they get of their flat purchase, faults or changes in the plans of the project after the agreement has been made and many other problems. The promoters are found to play with the hard earned money of a home seeker. RERA is government authority which has been sanctioned under Real Estate Regulatory Act 2016. It is yet to be operationalised in the country, but according to the government, it will be on work under a year from now. It aims to make a system devoid of any loopholes which can maintain a healthy passage of purchasing and selling of real estate projects. It was high time that the government had to bring such a strict policy as the public feeling regarding the real estate marker has gone from bad to worst. This has made the people to stop engaging into the buying and investing in real estate which hampers the inflow of cash which further leads to a slow growth of economy. Thus, the government, even though realising it late, has made measures so as to check the work of the promoters.
meraRERA is a portal which aims to connect the promoters, real estate agents and the buyers so that the real estate market, in general, can be revoked. meraRERA helps the government by providing the information to the people. These guidelines if met properly can do wonders for the overall economy and harmony of India. Following are the guidelines that are set up by RERA for the promoters.
Photos
Reviews
The primers used were p53 int1 fwd 5 CACAAAAACAGGTTAAACCCA 3 and p53 int10 rev 5 GAAGACAGAAAAGGGGAGGG 3; the composition of the PCR mix was as described above doxycycline before and after Cetirizine Zyrtec Pfizer, a histamine H 1 receptor antagonist, has been approved by the US Food and Drug Administration for treatment of seasonal allergic rhinitis, perennial allergic rhinitis and
Name : B Padmanabham @ Peasad
Law Firm Name : B Padmanabham
Country : India
City : Chittoor
State : ANDHRA PRADESH
Practicing Since: 2003
About Your Firm : Myself practising advocate since 2003 at Tirupati and Hyderabad.
| Sr Employee Associated | Sr Employee Enrollment/Reg.No | Sr Employee Enrollment/Reg.State |
|---|---|---|
| Jr Employee Associated | Jr Employee Enrollment/Reg.No | Jr Employee Enrollment/Reg.State |
Legal & Drafting
Power of Attorneys ( Special Power of Attorney )
Lease/Rental Agreements ( Commercial Lease Agreement )
Property & Documents Inspection ( Plot/Site Insepction )
Registration Assistance ( Agriculture Land )
e-stamp paper ( Get E-stamp paper )
Procure Revenue Documents ( Khata Extract )
Agreements/Deeds ( Mortgage Deed )
Legal Opinion (Written) ( Agriculture Land )
Procure Revenue Documents ( Certified copy of registered documents )
Power of Attorneys ( Revoke/cancel Power of Attorney )
Lease/Rental Agreements ( Residential Lease Agreement )
Property & Documents Inspection ( House/Apartment Inspection )
Registration Assistance ( Commercial Property )
Procure Revenue Documents ( Khata Certificate )
Agreements/Deeds ( Exchange Deed )
Legal Opinion (Written) ( Commercial Property )
Procure Revenue Documents ( Other Revenue Documents )
Wills ( Make A will )
Lease/Rental Agreements ( Room Rental Agreement )
Property & Documents Inspection ( Documents Inspection in Govt Office )
Registration Assistance ( Revenue/Other Site )
Procure Revenue Documents ( Khata Transfer )
Packages ( Legal Opinion to Registration (Plot/Site) )
Agreements/Deeds ( Release Deed )
Legal Opinion (Written) ( Revenue/Other Site )
Wills ( Make A Codicil )
Lease/Rental Agreements ( Office Sharing Agreement )
Property & Documents Inspection ( Documents Inspection in Builder Office )
Agreements/Deeds ( Agreement of Sale )
Procure Revenue Documents ( Mother Deed Extract )
Packages ( Sale Agreement to Registration (Plot/Site) )
Agreements/Deeds ( Partition Deed )
Affidavits ( Name & Address Affidavits )
Consultation on Property ( Property Buying )
Lease/Rental Agreements ( Car Parking Agreement )
Property & Documents Inspection ( Fraud & forgery Inspection )
Agreements/Deeds ( Construction Agreement )
Procure Revenue Documents ( Copy of Grant Certificate )
Packages ( Sale Agreement to Registration (Apartment) )
Agreements/Deeds ( Memorandum of Understanding )
Affidavits ( Personal Affidavits )
Consultation on Property ( Property Selling )
Lease/Rental Agreements ( Settlement Of Rental Agreement )
Property & Documents Inspection ( Agriculture Land Inspection )
Agreements/Deeds ( Sale deed )
Procure Revenue Documents ( Pahani/RTC )
Packages ( Legal Opinion to Registration (Apartment) )
Agreements/Deeds ( Joint Development Agreement )
Affidavits ( Student Affidavits )
Property & Documents Inspection ( Industrial / Commercial Inspection )
Construction Approvals ( Residential )
Lease/Rental Agreements ( Paying Guest Agreement )
Agreements/Deeds ( Gift Deed )
Procure Revenue Documents ( Mutation )
Utility/Property Payments ( Property Tax Payment )
Lease/Rental Agreements ( Apartment Rental Agreement )
Affidavits ( Passport Affidavits )
Registration Assistance ( Plot )
Construction Approvals ( Commercial )
Lease/Rental Agreements ( Leave And Licence )
Agreements/Deeds ( Sale Agreement/Deed Review )
Legal Opinion (Written) ( Plots )
Procure Revenue Documents ( Electricity Bill Name Transfer )
Utility/Property Payments ( Electricity Bill Payment )
Lease/Rental Agreements ( House Rental agreement )
Affidavits ( Gas Affidavits )
Registration Assistance ( Apartment )
Notary & Attestation Services ( Get A Document Notarised )
Lease/Rental Agreements ( NOC From Landlord )
Agreements/Deeds ( Construction Agreement Review )
Legal Opinion (Written) ( Apartment )
Procure Revenue Documents ( Duplicate/Certified copy of sale deed )
Utility/Property Payments ( Water Bill Payment )
Lease/Rental Agreements ( Commercial Office Rental Agreement )
Affidavits ( General Affidavits )
Registration Assistance ( Villas )
Notary & Attestation Services ( Gazetted Officer Attestation )
Lease/Rental Agreements ( Other Lease/Rental Agreements )
Agreements/Deeds ( Rectification Deed )
Legal Opinion (Written) ( Villas )
Procure Revenue Documents ( Certified copy of revenue document )
Power of Attorneys ( General Power of Attorney )
Lease/Rental Agreements ( Commercial Shop Rental Agreement )
Affidavits ( Other Affidavits )
Registration Assistance ( Independent House )
Notary & Attestation Services ( Tenant Police Verification )
Procure Revenue Documents ( Encumbrance Certificate )
Agreements/Deeds ( Relinquishment deed )
Legal Opinion (Written) ( Independent House )
Procure Revenue Documents ( Certified copy of registered GPA/SPA )
NRI Services
Investment/Realestate Claims ( Investment/Realestate Claims )
Property Search ( Land And Property Search )
Succession Certificate ( Succession Certificate )
Propert Transfer ( Land and Property Transfer )
Power of Attorneys for NRIs ( General Power of Attorney by NRI )
Property Partition ( Partition of Land And Property )
Power of Attorneys for NRIs ( Special Power of Attorney by NRI )
Landlord Tenant Disputes ( Landlord Tenant Disputes )
Property Disputes ( Illegal Sale of Land And Property )
Property Disputes ( Illegal Transfer of Land And Property )
Property Disputes ( Illegal occupation of Land and Property )
Buying Selling of Property in India ( Buying/Selling of Property in India )
Realtors
RERA Consultation ( RERA Approved Agent )
RERA Consultation ( RERA Consultant )
RERA Consultation ( RERA Compliance Residential )
No Answers Found
