The breast is composed of several glands and ducts that lead to the nipple and the surrounding colored area called the areola effect of kamagra on woman
B Padmanabham
B Padmanabham @ Peasad
22 Years Exp
RERA Compliance Residential (Show More)
Chittoor , Bhavani Nagar
View Answers by this Partner (0)
Profile Views : 46708
Information
Overview
The Real Estate agents are the medium between a buyer and a promoter. They have a strong presence in real estate sector as they have the marketing skills to profitably buy or sell a property. A buyer does not know all the property details and a promoter does not sell his properties himself, thus, a real estate agents’ role is of paramount importance. However, there are various unethical agents who fill their pockets by utilizing the gap between the buyer and the promoter. Also, there are many instances that after the sale of a property, the agent stops to take the responsibility of the problems related to that house. RERA India 2016 bill lays few guidelines for the functions and the duties of a real estate agent towards the buyer and the promoter. The formal bill of Real Estate Regulatory Act 2016 pdf can be found online at our website. meraRERA is making an effort to highlight those guidelines in a simpler form. An agent must adhere to these guidelines as these are made keeping in mind the problems arising due to the misconduct of real estate agents. Many a times the term ‘real estate agent’ is seen in a bitter taste in the Indian public. To make a healthy relationship between the agents with those of the buyers and promoters, the government is becoming strict as to grow a level of trust among different bodies of a real estate business.
Photos
Reviews
The primers used were p53 int1 fwd 5 CACAAAAACAGGTTAAACCCA 3 and p53 int10 rev 5 GAAGACAGAAAAGGGGAGGG 3; the composition of the PCR mix was as described above doxycycline before and after Cetirizine Zyrtec Pfizer, a histamine H 1 receptor antagonist, has been approved by the US Food and Drug Administration for treatment of seasonal allergic rhinitis, perennial allergic rhinitis and
Name : B Padmanabham @ Peasad
Law Firm Name : B Padmanabham
Country : India
City : Chittoor
State : ANDHRA PRADESH
Practicing Since: 2003
About Your Firm : Myself practising advocate since 2003 at Tirupati and Hyderabad.
| Sr Employee Associated | Sr Employee Enrollment/Reg.No | Sr Employee Enrollment/Reg.State |
|---|---|---|
| Jr Employee Associated | Jr Employee Enrollment/Reg.No | Jr Employee Enrollment/Reg.State |
Legal & Drafting
Agreements/Deeds ( Rectification Deed )
Legal Opinion (Written) ( Villas )
Procure Revenue Documents ( Certified copy of revenue document )
Lease/Rental Agreements ( Commercial Shop Rental Agreement )
Affidavits ( Other Affidavits )
Power of Attorneys ( General Power of Attorney )
Notary & Attestation Services ( Tenant Police Verification )
Procure Revenue Documents ( Encumbrance Certificate )
Registration Assistance ( Independent House )
Agreements/Deeds ( Relinquishment deed )
Legal Opinion (Written) ( Independent House )
Procure Revenue Documents ( Certified copy of registered GPA/SPA )
Power of Attorneys ( Special Power of Attorney )
Lease/Rental Agreements ( Commercial Lease Agreement )
Property & Documents Inspection ( Plot/Site Insepction )
e-stamp paper ( Get E-stamp paper )
Procure Revenue Documents ( Khata Extract )
Registration Assistance ( Agriculture Land )
Agreements/Deeds ( Mortgage Deed )
Legal Opinion (Written) ( Agriculture Land )
Procure Revenue Documents ( Certified copy of registered documents )
Power of Attorneys ( Revoke/cancel Power of Attorney )
Lease/Rental Agreements ( Residential Lease Agreement )
Property & Documents Inspection ( House/Apartment Inspection )
Procure Revenue Documents ( Khata Certificate )
Registration Assistance ( Commercial Property )
Agreements/Deeds ( Exchange Deed )
Legal Opinion (Written) ( Commercial Property )
Procure Revenue Documents ( Other Revenue Documents )
Wills ( Make A will )
Lease/Rental Agreements ( Room Rental Agreement )
Property & Documents Inspection ( Documents Inspection in Govt Office )
Registration Assistance ( Revenue/Other Site )
Procure Revenue Documents ( Khata Transfer )
Agreements/Deeds ( Release Deed )
Legal Opinion (Written) ( Revenue/Other Site )
Packages ( Legal Opinion to Registration (Plot/Site) )
Wills ( Make A Codicil )
Lease/Rental Agreements ( Office Sharing Agreement )
Property & Documents Inspection ( Documents Inspection in Builder Office )
Agreements/Deeds ( Agreement of Sale )
Procure Revenue Documents ( Mother Deed Extract )
Agreements/Deeds ( Partition Deed )
Affidavits ( Name & Address Affidavits )
Packages ( Sale Agreement to Registration (Plot/Site) )
Consultation on Property ( Property Buying )
Lease/Rental Agreements ( Car Parking Agreement )
Property & Documents Inspection ( Fraud & forgery Inspection )
Agreements/Deeds ( Construction Agreement )
Procure Revenue Documents ( Copy of Grant Certificate )
Agreements/Deeds ( Memorandum of Understanding )
Affidavits ( Personal Affidavits )
Packages ( Sale Agreement to Registration (Apartment) )
Consultation on Property ( Property Selling )
Lease/Rental Agreements ( Settlement Of Rental Agreement )
Property & Documents Inspection ( Agriculture Land Inspection )
Agreements/Deeds ( Sale deed )
Procure Revenue Documents ( Pahani/RTC )
Agreements/Deeds ( Joint Development Agreement )
Affidavits ( Student Affidavits )
Packages ( Legal Opinion to Registration (Apartment) )
Construction Approvals ( Residential )
Lease/Rental Agreements ( Paying Guest Agreement )
Property & Documents Inspection ( Industrial / Commercial Inspection )
Agreements/Deeds ( Gift Deed )
Procure Revenue Documents ( Mutation )
Lease/Rental Agreements ( Apartment Rental Agreement )
Affidavits ( Passport Affidavits )
Utility/Property Payments ( Property Tax Payment )
Construction Approvals ( Commercial )
Lease/Rental Agreements ( Leave And Licence )
Registration Assistance ( Plot )
Agreements/Deeds ( Sale Agreement/Deed Review )
Legal Opinion (Written) ( Plots )
Procure Revenue Documents ( Electricity Bill Name Transfer )
Lease/Rental Agreements ( House Rental agreement )
Affidavits ( Gas Affidavits )
Utility/Property Payments ( Electricity Bill Payment )
Notary & Attestation Services ( Get A Document Notarised )
Lease/Rental Agreements ( NOC From Landlord )
Registration Assistance ( Apartment )
Agreements/Deeds ( Construction Agreement Review )
Legal Opinion (Written) ( Apartment )
Procure Revenue Documents ( Duplicate/Certified copy of sale deed )
Lease/Rental Agreements ( Commercial Office Rental Agreement )
Affidavits ( General Affidavits )
Utility/Property Payments ( Water Bill Payment )
Notary & Attestation Services ( Gazetted Officer Attestation )
Lease/Rental Agreements ( Other Lease/Rental Agreements )
Registration Assistance ( Villas )
NRI Services
Power of Attorneys for NRIs ( General Power of Attorney by NRI )
Power of Attorneys for NRIs ( Special Power of Attorney by NRI )
Property Search ( Land And Property Search )
Propert Transfer ( Land and Property Transfer )
Property Partition ( Partition of Land And Property )
Landlord Tenant Disputes ( Landlord Tenant Disputes )
Property Disputes ( Illegal Sale of Land And Property )
Property Disputes ( Illegal Transfer of Land And Property )
Property Disputes ( Illegal occupation of Land and Property )
Investment/Realestate Claims ( Investment/Realestate Claims )
Buying Selling of Property in India ( Buying/Selling of Property in India )
Succession Certificate ( Succession Certificate )
Realtors
RERA Consultation ( RERA Approved Agent )
RERA Consultation ( RERA Consultant )
RERA Consultation ( RERA Compliance Residential )
No Answers Found
