The breast is composed of several glands and ducts that lead to the nipple and the surrounding colored area called the areola effect of kamagra on woman
B Padmanabham
B Padmanabham @ Peasad
22 Years Exp
Construction Agreement (Show More)
Chittoor , Bhavani Nagar
View Answers by this Partner (0)
Profile Views : 46700
Information
A construction agreement is a contract between the builder and the buyer. It describes the rights, duties and obligations of both parties in their dealings with each other. It is important for both the construction contractor and buyer to sign this agreement before they perform any work. The construction agreement can be used for both residential and commercial projects. The contents of the agreement may vary based on the nature of the project.
Some of the information included in a construction agreement are
• Names and addresses of both the parties
• Location and address where the construction work is to be done
• Description of the construction/renovation work to be done with timeline
• Materials that will be used during the construction
• Duration of the project
• Details and method of payment
• Methods to handle any change in work order
• The buyer and seller should check that the title flows in the parent documents are correct and does not miss any previous buyer or seller. This is a common type of fraud.Penalty in case the builder defaults in any of the clauses mentioned in the construction agreement
Photos
Reviews
The primers used were p53 int1 fwd 5 CACAAAAACAGGTTAAACCCA 3 and p53 int10 rev 5 GAAGACAGAAAAGGGGAGGG 3; the composition of the PCR mix was as described above doxycycline before and after Cetirizine Zyrtec Pfizer, a histamine H 1 receptor antagonist, has been approved by the US Food and Drug Administration for treatment of seasonal allergic rhinitis, perennial allergic rhinitis and
Name : B Padmanabham @ Peasad
Law Firm Name : B Padmanabham
Country : India
City : Chittoor
State : ANDHRA PRADESH
Practicing Since: 2003
About Your Firm : Myself practising advocate since 2003 at Tirupati and Hyderabad.
| Sr Employee Associated | Sr Employee Enrollment/Reg.No | Sr Employee Enrollment/Reg.State |
|---|---|---|
| Jr Employee Associated | Jr Employee Enrollment/Reg.No | Jr Employee Enrollment/Reg.State |
Legal & Drafting
Affidavits ( Passport Affidavits )
Utility/Property Payments ( Property Tax Payment )
Lease/Rental Agreements ( Apartment Rental Agreement )
Lease/Rental Agreements ( Leave And Licence )
Registration Assistance ( Plot )
Construction Approvals ( Commercial )
Legal Opinion (Written) ( Plots )
Procure Revenue Documents ( Electricity Bill Name Transfer )
Agreements/Deeds ( Sale Agreement/Deed Review )
Affidavits ( Gas Affidavits )
Utility/Property Payments ( Electricity Bill Payment )
Lease/Rental Agreements ( House Rental agreement )
Lease/Rental Agreements ( NOC From Landlord )
Registration Assistance ( Apartment )
Notary & Attestation Services ( Get A Document Notarised )
Legal Opinion (Written) ( Apartment )
Procure Revenue Documents ( Duplicate/Certified copy of sale deed )
Agreements/Deeds ( Construction Agreement Review )
Affidavits ( General Affidavits )
Utility/Property Payments ( Water Bill Payment )
Lease/Rental Agreements ( Commercial Office Rental Agreement )
Lease/Rental Agreements ( Other Lease/Rental Agreements )
Registration Assistance ( Villas )
Notary & Attestation Services ( Gazetted Officer Attestation )
Legal Opinion (Written) ( Villas )
Procure Revenue Documents ( Certified copy of revenue document )
Agreements/Deeds ( Rectification Deed )
Affidavits ( Other Affidavits )
Power of Attorneys ( General Power of Attorney )
Lease/Rental Agreements ( Commercial Shop Rental Agreement )
Procure Revenue Documents ( Encumbrance Certificate )
Registration Assistance ( Independent House )
Notary & Attestation Services ( Tenant Police Verification )
Legal Opinion (Written) ( Independent House )
Procure Revenue Documents ( Certified copy of registered GPA/SPA )
Agreements/Deeds ( Relinquishment deed )
Property & Documents Inspection ( Plot/Site Insepction )
Power of Attorneys ( Special Power of Attorney )
Lease/Rental Agreements ( Commercial Lease Agreement )
Procure Revenue Documents ( Khata Extract )
Registration Assistance ( Agriculture Land )
e-stamp paper ( Get E-stamp paper )
Legal Opinion (Written) ( Agriculture Land )
Procure Revenue Documents ( Certified copy of registered documents )
Agreements/Deeds ( Mortgage Deed )
Property & Documents Inspection ( House/Apartment Inspection )
Power of Attorneys ( Revoke/cancel Power of Attorney )
Lease/Rental Agreements ( Residential Lease Agreement )
Procure Revenue Documents ( Khata Certificate )
Registration Assistance ( Commercial Property )
Legal Opinion (Written) ( Commercial Property )
Procure Revenue Documents ( Other Revenue Documents )
Agreements/Deeds ( Exchange Deed )
Lease/Rental Agreements ( Room Rental Agreement )
Property & Documents Inspection ( Documents Inspection in Govt Office )
Wills ( Make A will )
Procure Revenue Documents ( Khata Transfer )
Registration Assistance ( Revenue/Other Site )
Legal Opinion (Written) ( Revenue/Other Site )
Packages ( Legal Opinion to Registration (Plot/Site) )
Agreements/Deeds ( Release Deed )
Lease/Rental Agreements ( Office Sharing Agreement )
Property & Documents Inspection ( Documents Inspection in Builder Office )
Wills ( Make A Codicil )
Procure Revenue Documents ( Mother Deed Extract )
Agreements/Deeds ( Agreement of Sale )
Affidavits ( Name & Address Affidavits )
Packages ( Sale Agreement to Registration (Plot/Site) )
Agreements/Deeds ( Partition Deed )
Lease/Rental Agreements ( Car Parking Agreement )
Property & Documents Inspection ( Fraud & forgery Inspection )
Consultation on Property ( Property Buying )
Procure Revenue Documents ( Copy of Grant Certificate )
Agreements/Deeds ( Construction Agreement )
Affidavits ( Personal Affidavits )
Packages ( Sale Agreement to Registration (Apartment) )
Agreements/Deeds ( Memorandum of Understanding )
Lease/Rental Agreements ( Settlement Of Rental Agreement )
Property & Documents Inspection ( Agriculture Land Inspection )
Consultation on Property ( Property Selling )
Procure Revenue Documents ( Pahani/RTC )
Agreements/Deeds ( Sale deed )
Affidavits ( Student Affidavits )
Packages ( Legal Opinion to Registration (Apartment) )
Agreements/Deeds ( Joint Development Agreement )
Lease/Rental Agreements ( Paying Guest Agreement )
Property & Documents Inspection ( Industrial / Commercial Inspection )
Construction Approvals ( Residential )
Procure Revenue Documents ( Mutation )
Agreements/Deeds ( Gift Deed )
NRI Services
Property Disputes ( Illegal occupation of Land and Property )
Buying Selling of Property in India ( Buying/Selling of Property in India )
Investment/Realestate Claims ( Investment/Realestate Claims )
Property Search ( Land And Property Search )
Succession Certificate ( Succession Certificate )
Propert Transfer ( Land and Property Transfer )
Power of Attorneys for NRIs ( General Power of Attorney by NRI )
Property Partition ( Partition of Land And Property )
Power of Attorneys for NRIs ( Special Power of Attorney by NRI )
Landlord Tenant Disputes ( Landlord Tenant Disputes )
Property Disputes ( Illegal Sale of Land And Property )
Property Disputes ( Illegal Transfer of Land And Property )
Realtors
RERA Consultation ( RERA Compliance Residential )
RERA Consultation ( RERA Approved Agent )
RERA Consultation ( RERA Consultant )
No Answers Found
